circad | circRNAs associated with diseases

circRNA-000284
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Cervical Cancer	ICD-10	Malignant neoplasm of cervix uteri (C53)
DBLink	Link to database	PMID	29511454
Experimental Method
Sample Type	HeLa, CaSki, SiHa, C-33A, SW756 Cell lines	Comparison	Human cervical cancer cells and cervical normal epithelial cells
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TATGTTGGTGGATCCTGTTCGGCA Reverse TGGTGGGTAGACCAAGACTTGTGA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Ma, HB, Yao, YN, Yu, JJ, Chen, XX, Li, HF (2018). Extensive profiling of circular RNAs and the potential regulatory role of circRNA-000284 in cell proliferation and invasion of cervical cancer via sponging miR-506. Am J Transl Res, 10, 2:592-604.